Sixty specimens of colorectal cancer tissues were obtained from patient who underwent surgery at Hazrat Rasool Hospital and Imam Khomeini Hospital. Tumoral tissues and blood samples from patients with colorectal cancer (60) and Adjacent normal tissue as controls from colorectal cancer patients (39) were obtained after subjects provided informed consent 10. Tissue samples were frozen and stored at -70 degrees. The pathological information of all patients was obtained from Pathology Department of Hazrat Rasoll Hospital and Imam Khomeini Hospital. Staging of colorectal cancer was performed according to the International Union against Cancer (UICC) which is based on (AJCC-TNM) classification. They consisted of 29 males and 31 female patients ranging in age from 28 to 81 years. The project was approved by the local ethics committee of the National Institute for Genetic Engineering and Biotechnology (NIGEB).

RNA extraction was carried out with the Tripure Isolation Reagent (Roche Applied Sciences). For cDNA synthesis, 1 μg of total RNA from each sample was used to synthesize first-strand cDNA according to the manufacturer s protocol (Ferments).

Evaluation of the expression level of VCAM-1 was performed by Reverse transcription-polymerase chain reaction (RT-PCR) with a one-step RT-PCR assay kit (Qiagen).The following primers were used for evaluating VCAM-1 expression: VCAM-1 forward 5 -AACCCAAACAAAGGCAGAG- 3 VCAM-1 reversed 5 -CACAGGATTTTCGGAGCA- 3 .

GAPDH was selected as the housekeeping gene for assessment of expression. The primer sequences for GAPDH were as follows: forward 5 - GCAGGGGGGAGCCAAAAGGGT -3 and reverse 5 - TGGGTGGCAGTGATGGCATGG -3 . Each 25-μl reaction mixture contained 5μl of cDNA solution in water, 0.6 μM of each primer (The concentration of primers used in the reaction was equivalent to 5 pM/μM , 6.3 mM water and 12.5 μL of Power SYBR Green PCR Master Mix. Cycle parameters were 94°C for 5 min to activate Taq, followed by 35 cycles of 94°C for 30 sec, 53 °C for 30 sec, and 72°C for 30sec. Finally, a cooling program cooled the reaction mixture to 40 °C. The products were underwent electrophoresis on 2% agarose gel.

Colonic cancer tissue was obtained from 31 female and 29 male patients undergoing surgery for sporadic colon cancer. The Characteristic of patients are listed in Table 1.

The average age of the patients was 50. Patients with average age older than 50 years were 61% (n=37) and average age of patients of younger than 50 years were 38% (n=23). There was no significant correlation between VCAM-1 expression level with age (P=0.103).

According to stages of the colorectal cancer that were histologically diagnosed, study of VCAM-1 expression in stage0 (n=3)5%, stage1 (n=17)28%, stage2 (n=16)26%, stage 3(n=17)28% and stage4 (n=7)12% of the patients was performed. In the present study data analysis showed that VCAM-1 expression level was correlated with stage of colorectal cancer (P=<0.000*).

In this study, there was no relation between VCAM-1 expression in colorectal cancer patients and tumor metastasis (than patients with primary tumors and non-metastatic colorectal cancer) (P=0.276).

The patients were divided into two groups according to tumor progression. The first group was based on the TNM classification. In This Category, VCAM-1 expression with tumor progression in the colon of walls was considerably significant (P=0.000*). Frequency classification of tumor progression included Tx (n=4, 7%), T2 (n=14, 23%), T3 (n=34, 57%) and T4 (n=8, 13%) in these patients, respectively. The second group was based on T1-T2 (n=20, 33%) and T3-T4 (n=40, 67%). The second group also had a significant association between expression VCAM-1 and tumor progression (P=0.003*).

Relationship between VCAM-1 expression and clinical risk factors of tumor size was measured in three groups. Most of the patients had tumor size between 1.5-3 cm (n=16) 27%, about 40% (n=24) of the patients had tumor size between3.1-5, While 33% (n=20) of the remaining patients between 5.6-12 cm. In the present study data analysis showed that VCAM-1 expression level was not correlated with tumor of size (p<0/419). Patients with lymph node involvement 58 % (N1&N2, n=35) and patients with non- lymph node involvement 42% (N0, n=25) were examined. Our results revealed that VCAM-1 expression level was correlated with lymph node involvement and non-lymph node involvement of the colorectal cancer (P=0.014*).

In this study, VCAM-1 expression level in tumoral tissues (n=60) and adjacent normal tissue (n=39) (at least 5 cm away from the tumor margin) were examined. Expression of VCAM-1 was detected in all the tumoral tissues (100%) and half of the adjacent normal tissues of patients (33%).The expression level of VCAM-1 gene in colorectal cancer specimens and adjacent normal tissues were determined by RT-PCR assay and the final data were standardized against GAPDH mRNA levels in samples. The expression level of VCAM-1 in tumoral tissue was higher than normal (P=0.000*)

Significant correlation between VCAM-1 expression and age, tumor of size, number of lymph nodes involved and metastasis in patients had not been observed, as shown in Table 2.

Since cancer is a progressive and multifactorial disease, despite recent advances in prevention, the clinical outcome of diagnosis and treatment of the disease is far away from expectation yet. Due to the high incidence of colorectal cancer, early diagnosis is highly important 11.

Vascular cell adhesion molecule -1 (VCAM-1) had been noticed for the first time more than two decades ago as endothelial cell adhesion receptor, with key function for the recruitment of leukocytes in a cellular immune response. In the past few years, a growing insight into the molecular understanding of tumor genesity and metastasis of a variety of VCAM-1 functions in cancer have been elucidated. High expressions of vascular cell adhesion molecule-1 associated with several cancers have been reported. That can be used as a diagnostic factor and a new therapeutic target various cancer. According to the above description, this study was conducted to investigate relationship between VCAM-1 expression with clinicopathologic features in Iranian patients with colorectal cancer and the introduction of vascular cell adhesion molecule-1 as a potential therapeutic target and a biomarker of disease activity. VCAM-1 is a 90-kDa glycoprotein that contains six or seven immunoglobulin domains and belongs to the immunoglobulin superfamily of adhesion molecules. In principle, this gene as a molecule induction in human umbilical vein endothelial cells was detected which is capable of binding to tumor cell lines and lymphoid. VCAM-1 is constitutively expressed on many different types of endothelial and stromal cells and mediates In spread to lymph nodes is a common characteristic of carcinomas. It is also a critical factor to determine the next therapies for cancer. VCAM-1 expression was showed a significant correlation with lymph node involvement. But correlation between VCAM-1 expression with the number of lymph node involve in metastasis was not observed. Okugawa et al. measured tissue concentrations of the sVCAM-1 in tumor and normal mucosa which showed that there is a significant association between expression of vascular involvement and lymph duct 25 .One of metastasis to other organs in patients with colorectal cancer tumor growth in the intestinal wall and pass it around and invade nearby organs such as the liver. In this study, we found that Semi-quantitative VCAM-1 expression with tumor progression in the colon wall layers (with either grouping) a significant was observed. Relation of VCAM-1 expression with clinical risk factors of tumor size was examined. Statistically significant correlation between VCAM-1 expression and tumor size was not observed in these patients. However, in patients with tumor sizes between 5.6-12 cm VCAM-1 expressions was observed in all the patients. Here, can be stated that any size of colorectal tumors express VCAM-1 gene. But matter how the tumor size is greater VCAM-1 expression in these samples increases. The risk of colorectal cancer increases with advancing age. More than 90% of cases occur in people aged 50 or older. Significant correlation between VCAM-1 expression and the mean age of patients was not observed. Significant correlation between semi-quantitative expressions VCAM-1 with sex was observed in patients. We observed that in all patients female with VCAM-1 expression.

VCAM-1 may be involved in the progression of human colorectal carcinoma. Differentially expressed vascular molecules may influence the functional characteristics of prostate cancer has been reported 7^, 15^, 18^, 19 .It is therefore conceivable that tumor cells that produce VCAM-1 might play a role in the adhesion of carcinoma cells to endothelium during disease progression. Alexiou et al have demonstrated that serum sVCAM-1 reflects tumor progression and metastasis in colorectal cancer 20. Kamezaki et al have reported that serum sVCAM-1 is extravagating leukocytes and represent new targets in colorectal cancer therapy. In general, an increasing number of studies on a variety of malignant diseases have suggested that VCAM-1 may play a role in the process of adhesion of tumor cells to endothelial cells and Neovascularization. Given that VCAM-1 in all tissues of the tumor and some normal samples expressed as a reliable diagnostic biomarker is not introduced. But if VCAM-1 expression was not observed in the specimens examined, it is likely that Normal or tumor tissue at stage0 is.

The controversial results which are obtained from several studies, show that serum levels of a variety of adhesion molecules, including VCAM-1 in cancer samples compared to normal samples has increased in various cancers 7^, 15^, 26^, 27.

In conclusion, we report that expression of VCAM-1 is associated with lymph node involvement, lymph node metastasis, clinical stage, tumor progression in the colon wall layers and gender of patients in colorectal cancer. The correlation with clinicopathologic factors including tumor progression, and involvement and metastasis of lymph node, the crucial role of VCAM-1 in cancer cell adhesion and spreading, and blood vessel development and angiogenesis determines. Since only patients with zero or only one metastatic site were enrolled in this study, further investigation on patients with higher degree metastasis is recommended.