Potato tubers (Solanum tuberosum cv. La Chipper) were harvested in the fall of 2016 in Erie County, Pennsylvania. Tubers were allowed to undergo skin for set for 14 days at room temperature and then stored at 8 oC for five months. Skin scrapings were placed onto Nash/Synder agar plates for selection of Fusarium species10. Following two days of growth at 22 oC putative Fusarium isolates were plated onto potato dextrose agar (PDA). Isolated cultures were grown at 22 oC and total DNA was isolated using a PowerSoil DNA Isolation Kit (www.Miobio.com). DNA was quantified using as spectrophotometer and the D1/D2 region of the 26S rRNA gene was amplified using the primers NL1 (GCATATCAATAAGCGGAGGA) and NL4 (GGTCCGTGTTTCAAGACGG 8. An additional genomic region encoding for the 18 ITS was amplified using the primers ITS1 (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCGTTCTTCATCGATGC). PCR products were purified and then sent to Retrogen (http://www.retrogen.com) for Sanger sequencing using the same primers used for PCR amplification. DNA sequences were then analyzed using BLASTn against the NCBI database using high similarity and a search restricted to fungi.

The fungal strains Aspergillus niger (ATCC: 16888) and Pythium ultimum(ATCC: 58811) were purchased from American Type Culture Collection (www.atcc.org) and maintained on potato dextrose agar (PDA). Alternaria alternatawas isolated from leaves of hardy kiwi (Actinidia arguta) grown at the Lake Erie Regional Grape Research and Extension Center (LERGREC) located in North East, PA. Hardy kiwi leaves were harvested and placed in closed petri dishes until fungal hyphae were visible. Hyphae were then scraped on to PDA and single isolates were selected and maintained on PDA. Epicoccum nigrum, Gnomoniopsis smithogilvyi, and Phoma medicaginis were isolated from phloem tissue obtained from American Chestnut trees located at (LERGREC) that exhibited cankers. Cultures were maintained on PDA and isolates were identified using DNA barcodes based on the 18ITS ribosomal region. Single culture isolates were grown on PDA, and DNA was isolated using a PowerSoil DNA Isolation Kit. DNA was quantified using as spectrophotometer and PCR was accomplished using 18 ITS primers described above. Sanger sequencing was conducted on the purified PCR products and results were evaluated using BLASTn against the NBCI database narrowed to fungal accessions.

Fungal cultures were plated onto PDA plates and placed in 9.5 Liter BBL GasPak chamber (http://www.bd.com/ds/productCenter/ES-Gaspak.asp) containing filter paper strips that had 22.5 ul of 1,4-dimethylnaphthalene spotted on to it. Control chambers contained 22.5 ul of water in place of DMN. The chambers were placed at 22 oC and incubated for two days. The rate of application of DMN was selected based on previous experiments with potatoes that have shown that this application rate results in a DMN residue level on potatoes similar to that found in commercial storage units3.

Fungal spores from Fusarium oxysporum and Aspergillus niger were isolated using a modification of the procedure of Espinel-Ingroff and Kerkering 4. A sporulating culture was washed with 1 ml of sterile water. The water was transferred to a microfuge tube, centrifuged at 9400 g for 1 min and the supernatant was transferred to a sterile microfuge tube. A 500 ul sample was placed into a sterile spectrophotometry cuvette and percent transmittance at 530 nm was determined and then adjusted to 75 ± 1%. The solution was then diluted 1:100 with sterile water and 10 ul was plated on PDA agar and the cultures were incubated at 25 oC for 24 hrs with and without DMN. Germination was determined by the presence of mycelia and amount of growth was determined by measuring size of the mycelial spread for each germination.

Cultures of A. alternata, A. niger, E. nigrum, G. smithogilvyi, P. medicaginis, and P. ultimum were washed with 1 to 3 ml of sterile water and liquid was placed in a sterile tube and diluted 1:100 with water. Following dilution, 100 ul sample was spread on to PDA and then treated in a GasPak chamber as described for Fusarium oxysporum. Cultures were photographed after two days of exposure to DMN or the water control.

Cultures of Alternaria alternata were allowed to grow across the surface of a plate containing PDA. Using a sterile scalpel mycelial mats of about 0.5 cm were placed on to fresh PDA plates. One set of plates was transferred to a to GasPak chamber for DMN for 24 hrs and another segment of the same culture was placed in a GasPak chamber and exposed to water. Sporulation was assessed after 24 hrs.

Species identification of the isolated strain of Fusarium was based on DNA sequence of the ITS and NL amplified regions. The ITS region revealed similarity to Fusarium oxysporum while the NL regions demonstrated sequence similarity to F. oxysporum sp. lycopersici (Table 1).

The Fusarium oxysporum isolate, when grown in the presence of DMN for four days, exhibited a decrease in growth (Figure 1). The average size for Fusarium mycelia in the controls was 9.8 ± 0.7 cm while exposure to DMN resulted in an average growth size to 3.0 ± 0.5 cm. The difference was statistically significant based on T-test analysis. However, the difference in the number of spores that germinated in the presence of DMN, compared to the controls, was not statistically significant. Suggesting that, at the concentration used here, DMN is not fungicidal but fungistatic. DMN did not kill the Fusarium cultures but inhibited mycelial growth rates. The ability of DMN to suppress Fusarium growth is significant because Fusarium spp. are the causative agents of rots and wilts in potato15. While no PAH has been shown to specifically inhibit the growth of Fusarium, mixtures of hydrophobic oils from clove and lemon grass have been shown to decrease the growth of F. oxysporum sp. Lycopersici 17.

Treatment of Alternaria alternata, Aspergillus niger, E. nigrum, G. smithogilvyi, P. medicaginis, and P. ultimum with DMN resulted in suppression of mycelial growth (Figure 2). The morphology of the mycelium prevents quantitative assessment of the growth rates. The mycelial growth after DMN exposure was less than 5 mm for A. alternata,E. nigrum, and P. medicaginis. The diversity of the species examined ranged from the Ascomycota (A. alternaria, A. niger, E. nigrum, G. smithogilvyi, and P. medicaginis) to the oomycota (P. ultimum) suggesting that DMN suppression of fungal growth appears to be a broad-spectrum response and does not involve inhibition of species-specific pathways. Similar fungistatic activity was found with mixtures of essential 691314 Complex mixtures of essential oils may contain polycyclic hydrocarbons (PAHs) with structure similarity to DMN but there is limited literature surrounding substituted naphthalene and mycelial inhibition. Investigations have been conducted using a number of fungal species to mitigate PAH soil contaminants via metabolism but the effect of PAH on rate of growth of fungi was not evaluated.

Treatment of A. Alternaria with DMN resulted in a decrease in sporulation compared to controls (Figure 3). The suppression of sporulation may be a function of reduced growth rate by DMN and not a result in the alteration of the sporulation developmental pathway directly.